 | ||||
Genetic Transcription & Translation Review Questions
These are review questions from the Virtual Cell Biology Classroom, designed to help students better understand genetic transcription & translation. They are based on materials that can be found on the Molecular Genetics: Transcription & Translation Lecture Main Page.
1. Transcribe the DNA sequences below:
a. GGGGGTCTTAGGTTGCGTTAG
b. GTACTGAATTGATGAGATGTTCTG
2. How are transcription & translation similar How do they differ?
3. Explain the difference between replication & transcription.
4. Describe the different types of RNA, their names and their roles in transcription & translation.
5. What is a codon, and what is its role in translation?
6. What is an anti-codon, and what it its role in translation?
7. Translate the RNA sequences below by referring to the the Table of Standard Genetic Code from the Transcription Translation Homework Activity.
a. ATGGGGGGTCTTAGGTTGCGTTAG
b. ATGGTACTGAATTGGGTGTGTTGA
8. Now see if you can do this the other way.Write the correct code for the following protein.There will be more than one correct answer. Refer to the Table of Standard Genetic Code from the Transcription Translation Homework Activity:
a. Met-Leu – Val – Cys – Lys – Stop
b. Met - His– Ser – Thr – Stop Val – Gly – Lys - Stop
9. Translate these by referring to the the Table of Standard Genetic Code from the Transcription Translation Homework Activity.
a. ATGGGGGCATAG
b. ATGGGTGCGTAA
c. What do you notice about the two proteins created?
Page last updated 9/2012
| ||||
These multiple choice and true/false questions are designed to help students practice and test their understanding of Genetic Transcription & Translation.
| ||||||
You have free access to a large collection of materials used in a college-level introductory Cell Biology Course. The Virtual Cell Biology Classroom provides a wide range of free educational resources including Power Point Lectures, Study Guides, Review Questions and Practice Test Questions.
SPO VIRTUAL CLASSROOMS
| ||||||
SPO is a FREE science education website. Donations are key in helping us provide this resource with fewer ads.
Please help!
(This donation link uses PayPal on a secure connection.)
Molecular Genetics: Transcription & Translation
Review Questions
Virtual Cell Biology Classroom of Science Prof Online
| ||||||
