Textbooks
CELL BIOLOGYMICROBIOLOGYHOMESCHOOL SCIENCEFOR INSTRUCTORSHOW TO USE SPO 


Genetic Transcription & Translation Review Questions
Transcription & Translation
Practice Test Questions

These multiple choice and true/false questions are designed to help students practice and test their understanding of Genetic Transcription & Translation.
Transcription, National Human Genome Research INstitute
Virtual Cell Biology
Classroom






You have free access to a large collection of materials used in a college-level introductory Cell Biology Course. The Virtual Cell Biology Classroom provides a wide range of free educational resources including Power Point Lectures, Study Guides, Review Questions and Practice Test Questions.
Endomembrane System of a Eukaryotic Cell, Mariana Ruiz

facebook link
SPO twitter
Tamislinked in page
< Go to LECTURE MAIN PAGE
SPO VIRTUAL CLASSROOMS

 Molecular Genetics: Transcription & Translation
Review Questions

Virtual Cell Biology Classroom of Science Prof Online

Page last updated: 6/2014
These are review questions from the Virtual Cell Biology Classroom, designed to help students better understand genetic transcription & translation. They are based on materials that can be found on the Molecular Genetics: Transcription & Translation Lecture Main Page.
​​
4. Describe the different types of RNA, their names and their roles in transcription & translation.



5. What is a codon, and what is its role in translation?



6. What is an anti-codon, and what it its role in translation?



7. Translate the RNA sequences below by referring to the the Table of Standard Genetic Code from the Transcription Translation Homework Activity.
a. ATGGGGGGTCTTAGGTTGCGTTAG
b. ATGGTACTGAATTGGGTGTGTTGA



8. Now see if you can do this the other way.Write the correct code for the following protein.There will be more than one correct answer. Refer to the Table of Standard Genetic Code from the Transcription Translation Homework Activity:
a. Met-Leu – Val – Cys – Lys – Stop
b. Met - His– Ser – Thr – Stop Val – Gly – Lys - Stop



9. Translate these by referring to the the Table of Standard Genetic Code from the Transcription Translation Homework Activity.
a. ATGGGGGCATAG
b. ATGGGTGCGTAA
c. What do you notice about the two proteins created?

1. Transcribe the DNA sequences below:
a. GGGCTTAGGTTGTAG
b. GTACTGGATGAGTTC



2. How are transcription & translation similar How do they differ?



3. Explain the difference between replication & transcription.