 | ||||
Genetic Transcription & Translation Review Qus
| ||||
These multiple choice and true/false questions are designed to help students practice and test their understanding of Genetic Transcription & Translation.
SPO VIRTUAL CLASSROOMS
Molecular Genetics:
Transcription & Translation
Review Questions
from Science Prof Online
| ||||||
These are review designed to help students better understand gene expression & epigenetics. They are based on materials that can be found on the Molecular Genetics: Transcription & Translation Lecture Main Page.
3. Explain the difference between replication & transcription.
4. Describe the different types of RNA, their names and the roles each of them play in transcription & translation.
5. What is an anti-codon, and what it its role in translation?
6. Translate the RNA sequence below by referring to the the Table of Standard Genetic Code from the Transcription Translation Homework Activity.
a. TAGATGGGGGGTCTTAGGTTGCGTACT
b. TAGATGGTACTGAATTGGGTGTGTATT
1. What is a codon, and what is its role in translation?
2. How are
transcription & translation similar How do they differ?
Page last updated 1/2016
7. Now see if you can do this the other way.Write the correct DNA code for the following protein. There will be more than one correct answer. Refer to the Table of Standard Genetic Code from the Transcription Translation Homework Activity:
a. Met-Leu – Val – Cys – Lys – Stop
b. Met - His– Ser – Thr – Stop Val – Gly – Lys - Stop
8. Translate these by referring to the the Table of Standard Genetic Code from the Transcription Translation Homework Activity.
a. TAGATGGGTGCGATT
b. TAGATAGGGGCAACT
c. What do you notice about the two proteins created?
9. Where does the energy come from for RNA nucleotides to be polymerized into an mRNA molecule?
